View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271-Insertion-13 (Length: 177)
Name: NF1271-Insertion-13
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271-Insertion-13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 7e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 7e-26
Query Start/End: Original strand, 48 - 123
Target Start/End: Original strand, 28677084 - 28677159
Alignment:
| Q |
48 |
ttttatattgacattaatcacaactcttcaaatgatcatattatatcggggtaactaggtttcaatctttatcaat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
28677084 |
ttttatattgacattaatcacaactcttcaattggtcatattatattggggtaactaagtttcaatctttatcaat |
28677159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University