View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1271-Insertion-2 (Length: 134)

Name: NF1271-Insertion-2
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1271-Insertion-2
NF1271-Insertion-2
[»] chr4 (1 HSPs)
chr4 (8-134)||(54155903-54156027)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 54155903 - 54156027
Alignment:
8 gatagctctcttttaccccaatctctaggcttcactctctggaggaaccagaaatatggctcccaaaaaggcgcgattatgcatggtaacttccatttat 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
54155903 gatagctctcttttaccccaatctctaggcttcactctctggaggaaccagaaat--ggctcccaaaaaggcgcgattatgcatggtaacttccatttat 54156000  T
108 ttatttactctgctaccatttgattga 134  Q
    ||||||||||||||| |||||||||||    
54156001 ttatttactctgctatcatttgattga 54156027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University