View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271-Insertion-2 (Length: 134)
Name: NF1271-Insertion-2
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271-Insertion-2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 54155903 - 54156027
Alignment:
| Q |
8 |
gatagctctcttttaccccaatctctaggcttcactctctggaggaaccagaaatatggctcccaaaaaggcgcgattatgcatggtaacttccatttat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54155903 |
gatagctctcttttaccccaatctctaggcttcactctctggaggaaccagaaat--ggctcccaaaaaggcgcgattatgcatggtaacttccatttat |
54156000 |
T |
|
| Q |
108 |
ttatttactctgctaccatttgattga |
134 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
54156001 |
ttatttactctgctatcatttgattga |
54156027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University