View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271-Insertion-8 (Length: 164)
Name: NF1271-Insertion-8
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271-Insertion-8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 5e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 3 - 161
Target Start/End: Original strand, 15073198 - 15073356
Alignment:
| Q |
3 |
caacaggtataatggttttggttgaagaatcgatagatattctggtttataaggtgcaaagtggtgtcttgcatgcttaataatgaagctggattgttag |
102 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15073198 |
caacatgtttaatggttttggttgaagaatcgatagatactctggtttataaggtgtaaagtggtgtcttgcatgcttaataatgaagctggattgttag |
15073297 |
T |
|
| Q |
103 |
ttaaatcatgtgttctcttttgctctttctgcataactgtgcaggtgggaagatgtttg |
161 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15073298 |
ttaaatcatgggttctcttttgctctttctgcataactgtgcaggtgggaagatgtttg |
15073356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University