View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12710_high_18 (Length: 227)
Name: NF12710_high_18
Description: NF12710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12710_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 36003553 - 36003773
Alignment:
| Q |
7 |
catatggctacctgccaaaggagaacatgccctgtaatgctgccacaagtgagaaaacacacactcatgcataatgaggatgttacttgataccgttatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36003553 |
catatggctacctgccaaaggagaacatgccctgtaatgctgccacaagtgagaaaacacacactcatgcataatgaggatgttacttgataacgttatt |
36003652 |
T |
|
| Q |
107 |
tatggcttcctaacaatgagcatatcctatggaacaatgccttcattttgcgtttcgtatggttttattcctttgttctatagataggaaccattctttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36003653 |
tatggcttcctaacaatgagcatatcctatggaacaatgccttcattttgcgtttcgtatggttttattcctttgttctatagataggaaccattctttt |
36003752 |
T |
|
| Q |
207 |
aatttgatgaacattatttta |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36003753 |
aatttgatgaacattatttta |
36003773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University