View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12710_low_13 (Length: 348)
Name: NF12710_low_13
Description: NF12710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12710_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 336
Target Start/End: Original strand, 16224834 - 16225158
Alignment:
| Q |
18 |
gtttttaaaatcttataccttctatttttccactccataggttatcaattatgt----ttattttgtgtgatactactactttggaatataagaagattg |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16224834 |
gtttttaaaatcttaaaccttctatttttcccctccataggttatcaattaagtattattattttgtgtgattctactactttggaatataagaagattg |
16224933 |
T |
 |
| Q |
114 |
aaaatgaatttctgtgagccctata----atccctaaaccctattcttattgcctattggtaaccactgtactttgcggctgttgtgaagatcaagttat |
209 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16224934 |
aaaaggaatttctgtgagccctatatataaaccctaaaccctatgtttattgcctattggtacccactgtactttgcggctgttgtgaagatcaagttat |
16225033 |
T |
 |
| Q |
210 |
aattgctaggatagtttctatttggttcatgttagttttcaacaaagtgatttcaattatgttgtttgaacactttaaactagttattggttgttgtact |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16225034 |
aattgctaggatagtttctatttggttcatgttagttttcaacaaagtgatttcaattatgttgtttgaacactttaaactagttattggttgttgtatt |
16225133 |
T |
 |
| Q |
310 |
ctcaataatatgatgtagtcctatgct |
336 |
Q |
| |
|
| ||||| |||||||||| ||||||| |
|
|
| T |
16225134 |
cacaata--atgatgtagttctatgct |
16225158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University