View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12710_low_18 (Length: 275)
Name: NF12710_low_18
Description: NF12710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12710_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 14 - 257
Target Start/End: Original strand, 34918771 - 34919014
Alignment:
| Q |
14 |
cagagacagcaactacaaaacgatcaaatcaagaaactaaaacaaggattctataatgtctctcattccaagcttctttggcggtagacaaaacaacgtt |
113 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34918771 |
cagaaacagcaactacgaaacgatcaaatcaagaaactaaaacaaggattctacaatgtctctcattccaagcttctttggcggtagacaaaacaacgtt |
34918870 |
T |
 |
| Q |
114 |
tttgatccattctcaatggatatatgggatccactccaaggttttccatcatctgctcgtgaaacaactgcactagcaaacacacgtgtggactggaaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34918871 |
tttgatccattctcaatggatatatgggatccactccaaggttttccatcatctgctcgtgaaacaactgcactagcaaacacacgtgtggactggaaag |
34918970 |
T |
 |
| Q |
214 |
aaacacaagaagctcacgtgttcagtgtagatcttcctggtttg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34918971 |
aaacacaagaagctcacgtgttcagtgtagatcttcctggtttg |
34919014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University