View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12710_low_20 (Length: 228)
Name: NF12710_low_20
Description: NF12710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12710_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 2347124 - 2347320
Alignment:
| Q |
18 |
tttctttggcttcatttgtgatggtttctttattgtaactttcttctttgatggggcatcataaaaaatagactgtgtgtcaccagaaattgattttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2347124 |
tttctttggcttcatttgtgatggtttctttattgtaactttcttctttgatggggcatcataaaaaatagactgtgtgtcaccagaaattgattttgga |
2347223 |
T |
|
| Q |
118 |
taggttaccagatctttaattatggatgcatcaatatcttcaaaaattgtgctttggtcatcactttcttcgctacgaacagtagccacatcctttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2347224 |
taggttaccagatctttaattatggatgcatcaatatcttcaaaaactgtgctttggtcatcactttcttcgctacgaacagtagccacatcctttg |
2347320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University