View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12711_high_4 (Length: 241)
Name: NF12711_high_4
Description: NF12711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12711_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 42411555 - 42411344
Alignment:
| Q |
18 |
ggattacatatacatacataaatacaaagaaataattggataaaattcatgcggggctcactgaatcatgcaggtctcatttcctatttggaggttccca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42411555 |
ggattacatatacatacataaatacaaagaaataattggataaaattcatgtggggctcactgaatcatgcaggtctcatttcctatttggaggttccca |
42411456 |
T |
 |
| Q |
118 |
catgaattgcactcaataatagagacaatgttgaaaaaatctgttgctaacacctctctacttacaaatatacatatgaatggaatgagctaaattgtgt |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
42411455 |
catgaattacactcaataatagagacaatgttgaaaaaatctgttgctaacacctctctacgtacaaatatacaaatgaatggaataagctaaattgtgt |
42411356 |
T |
 |
| Q |
218 |
gttatctgtgct |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42411355 |
gttatctgtgct |
42411344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University