View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12711_high_6 (Length: 201)
Name: NF12711_high_6
Description: NF12711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12711_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 15 - 185
Target Start/End: Complemental strand, 36674144 - 36673975
Alignment:
| Q |
15 |
cacagatcactatactaatggagagactgactttaacaatatggttggatgaactgtgtgacgcaactgattgttatcgctgtagacaatgccattgggg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
36674144 |
cacagatcactatactaatggagagactgactttaacaatatggttggatgaactgtgtgacgcaactgattgtt-tcgctgtcgacaatgccattgggg |
36674046 |
T |
|
| Q |
115 |
taggaaagatgggaatgatgtaccaaggatttcttcctaatggtcagttactggctattaagagaatattt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36674045 |
taggaaagatgggaatgatgtaccaaggatttcttcctaatggtcagttactggctattaagagaatattt |
36673975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 36676899 - 36676731
Alignment:
| Q |
15 |
cacagatcactatactaatggagagactgactttaacaatatggttggatgaactgtgtgacgcaactgattgttatcgctgtagacaatgccattgggg |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||| | || ||||||||||||||| |||||| |||||||||| ||||||| | ||||| |||||||||||||||| |
|
|
| T |
36676899 |
cacagatctctatactaatggagagactaaattcaacaatatggttggaagaactgcgtgacgcaaccgattgtttt-gctgtggacaatgccattgggg |
36676801 |
T |
|
| Q |
115 |
taggaaagatgggaatgatgtaccaaggatttcttcctaatggtcagttactggctattaagagaatatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||| |||||||| |||| |
|
|
| T |
36676800 |
taggaaagatgggaatgatgtaccaaggatttctgcctaatggtcaattactagctgttaagagactatt |
36676731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 42 - 179
Target Start/End: Complemental strand, 36684545 - 36684409
Alignment:
| Q |
42 |
tgactttaacaatatggttggatgaactgtgtgacgcaactgattgttatcgctgtagacaatgccattggggtaggaaagatgggaatgatgtaccaag |
141 |
Q |
| |
|
|||||| |||||||||||| || ||||| | ||| |||| || |||| | ||| ||||||| ||||||||||| |||||||||||||||||||| || | |
|
|
| T |
36684545 |
tgacttcaacaatatggttagaagaactccgggacacaaccgactgtttt-gctatagacaacgccattggggtgggaaagatgggaatgatgtatcagg |
36684447 |
T |
|
| Q |
142 |
gatttcttcctaatggtcagttactggctattaagaga |
179 |
Q |
| |
|
|| ||| || |||||||||||||| || |||||||| |
|
|
| T |
36684446 |
gaaatctaccaaatggtcagttactagccgttaagaga |
36684409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University