View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12711_low_3 (Length: 302)
Name: NF12711_low_3
Description: NF12711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12711_low_3 |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0606 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 4214 - 3947
Alignment:
| Q |
20 |
tgtgtacttgtagagagtacaatagtagacaccctagtagcaatgatgccgagtataacactaggctttggtattctgtcaaagtgatgatttgtaaatg |
119 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4214 |
tgtgtacttgtaaagagtacaatagtaaacaccctagtagcgatgatgctgagtagaacactaggctttggtattctgtcaaagtgatgatttgtaaatg |
4115 |
T |
 |
| Q |
120 |
atctcagagtctatattagtttataaattatggatgcaatatgagaacaatgaaatgtctttaaggatcacaatatcataaaatttgattttgattcaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4114 |
atctcagagtctatattagtttataaattatggatgcaatatgagaacaatgaaatgtctttaaggatcacaatatcataaaatttgattttgattcacc |
4015 |
T |
 |
| Q |
220 |
tattaacatatgcataatgacttatctaaaatatggtagttctgatgatcttgatggtgcaattttat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
4014 |
tattaacatatgcataatgacttatctaaaatatggtagtcctgacgatcttgatggtgcaattttat |
3947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 193 - 237
Target Start/End: Original strand, 20649259 - 20649303
Alignment:
| Q |
193 |
tatcataaaatttgattttgattcaactattaacatatgcataat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
20649259 |
tatcataaaatttgattttgattcaactattaaaatatgtataat |
20649303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University