View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12711_low_4 (Length: 264)
Name: NF12711_low_4
Description: NF12711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12711_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 37 - 256
Target Start/End: Original strand, 33940048 - 33940268
Alignment:
| Q |
37 |
taatcaatttgtcaaaaccgagtccaactagctagctagctagtgaacctgaaaatcaggtaagaatggatcgatcaatatctaattttgaatcattatt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33940048 |
taatcaatttgtcaaaaccgagtccaactagctagctagctagtgaacctgaaaatcaggtaagaatggatcgatcaatatctaattttgaatcattatt |
33940147 |
T |
|
| Q |
137 |
tgagcatcactatctcatgatctgcaacaatgct-agtgccatcacacgtagtcaacaattcctatatccaaggataactatacatatagccatgtagtt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33940148 |
tgagcatcactatctcatgatctgcaacaatgctaagtgccatcacacgtagtcaacaattcctatatccaaggataactatacatatagccatgtagtt |
33940247 |
T |
|
| Q |
236 |
ggatttcataccacaggttct |
256 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
33940248 |
ggatttcataccacagattct |
33940268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University