View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12712_high_7 (Length: 241)
Name: NF12712_high_7
Description: NF12712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12712_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 39092533 - 39092756
Alignment:
| Q |
1 |
ttaagattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaacaacttttggtactctttcttttgggtagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092533 |
ttaagattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaacaacttttggtactctttcttttgggtagttt |
39092632 |
T |
 |
| Q |
101 |
gatgatcagactcagggggattaactatcttatattctctctcttattgggtcaagattgctcgaatattatttactagagtactacactcatgcatctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092633 |
gatgatcagactcagggggattaactatcttatattctctctctt-ttgggtcaagattgctcgaatattatttactagagtactacactcatgcatctc |
39092731 |
T |
 |
| Q |
201 |
atgtatcagaaataatatcttatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39092732 |
atgtatcagaaataatatcttatgt |
39092756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 39089130 - 39089197
Alignment:
| Q |
4 |
agattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaacaa |
71 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
39089130 |
agattattgtggtcaattggtgcttgaactgttgttgtggatatcactttgatggaagccatgaacaa |
39089197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 39083478 - 39083542
Alignment:
| Q |
4 |
agattgttgttgtcaattggtgcttgaactgttgttgtggatatcactttcatggaatccatgaa |
68 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
39083478 |
agattattgttgtcaattggtgcttgaacttttgttgtggatatcacactaatggaatccatgaa |
39083542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University