View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12712_high_9 (Length: 221)
Name: NF12712_high_9
Description: NF12712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12712_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 7 - 132
Target Start/End: Complemental strand, 19682459 - 19682334
Alignment:
| Q |
7 |
ggagcagcacagacactcgacccttattggaccttgaagaatgccaataacgacagcaatatgttgggaacgcctgttgaagcttgaccgctggagagga |
106 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19682459 |
ggagcagcacaaacactcgacccttattggaccttgaagaatgccaataacaacaacaataggttgggaacgcctgttgaagcttgaccactggagagga |
19682360 |
T |
 |
| Q |
107 |
aatgtcgaatccaaccagtgaggggt |
132 |
Q |
| |
|
|||||||||||||||| ||||||||| |
|
|
| T |
19682359 |
aatgtcgaatccaacctgtgaggggt |
19682334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University