View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12713_low_5 (Length: 253)
Name: NF12713_low_5
Description: NF12713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12713_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 49354312 - 49354204
Alignment:
| Q |
128 |
tttatttcatttttgtgatttaatgtaattgggtttggttggtatgcaggaattgaagcacgagggtttgtgtttggttctgcagttgcgttgggcattg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49354312 |
tttatttcatttttgtgatttaatgtaattgggtttggttggtatgcaggaattgaagcacgagggtttgtgtttggttctgcagttgcgttgggcattg |
49354213 |
T |
 |
| Q |
228 |
gtgcaaagt |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
49354212 |
gtgcaaagt |
49354204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 49354429 - 49354359
Alignment:
| Q |
13 |
cagagacatgcacatttcagttgttgctggtatggtactacatcactattaccctcatgcaatactcattt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49354429 |
cagagacatgcacatttcagttgttgctggtatggtactacatcactcttaccctcatgcaatactcattt |
49354359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University