View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12714_low_10 (Length: 263)
Name: NF12714_low_10
Description: NF12714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12714_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 19 - 255
Target Start/End: Original strand, 35425426 - 35425655
Alignment:
| Q |
19 |
tgcatctcagtccaacttattggaaccaaagttgcacctaaatacagaaagtacaacaggttgaggcacagatgaatttgaccatatatactttgtagga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35425426 |
tgcatctcagtccaacttattggaaccaaagttgcacctaaatacagaaagtacaacaggttgaggcacaaatgaatttgaacatatatactttgtagga |
35425525 |
T |
 |
| Q |
119 |
aaagagaaaggnnnnnnnnnnnngataaataaaactgcattgcattgagtgtcacagtcagataagcttaaaataaaactaaacagatttgtttccggat |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
35425526 |
aaagagaaagg--aaaaaaaaaagataaataaaactgcattgcattgagtgtcacagtcagataagct-----taaaactaaacagttttgtttccggat |
35425618 |
T |
 |
| Q |
219 |
tgccggccatgtatgaaaatcccagcctgtctgtgct |
255 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35425619 |
tgccggccatgtacgaaaatcccagcctgtcagtgct |
35425655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University