View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12714_low_12 (Length: 250)
Name: NF12714_low_12
Description: NF12714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12714_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 232
Target Start/End: Complemental strand, 37089882 - 37089667
Alignment:
| Q |
17 |
taggtcactgaattcggtcgttataagcttcattcattctctgtgaagcgctaacacatacacggacatgataccaaaatatcggggctcacaatattga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37089882 |
taggtcactgaattcggtcgttataagcttcattcattctctgtgaagcgctaacacatacacggacatgataccaaaatatcggggctcacaatattga |
37089783 |
T |
|
| Q |
117 |
aaactagacatgcattcaatatgaagtatcggtgttgaatagtttgtttctctttcaaggcttaactcgagccaattttcctctgtactagtcaagatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37089782 |
aaactagacatgcattcaatatgaagtatcggtgctgaatagtttgtttctctttcaaggcttaactcgagccaattttcctttgtactagtcaagatta |
37089683 |
T |
|
| Q |
217 |
ctatagatgataaatt |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37089682 |
ctatagatgataaatt |
37089667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University