View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12714_low_14 (Length: 248)
Name: NF12714_low_14
Description: NF12714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12714_low_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 248
Target Start/End: Complemental strand, 40171262 - 40171026
Alignment:
| Q |
12 |
acagaccacactcttaaaatcgggacaaacagcaccatcattgcttggagcaatgaatgctttaactccagtcttaatttgactagctttggtcgaacat |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40171262 |
acagaccacactcttaaaatctggacaaacagcaccatcattgcttggagcaatgaatgctttaactccagtcttaatttgactagctttggtcgaacat |
40171163 |
T |
 |
| Q |
112 |
gcctctttggagagcagaaatccactcgattttactctcgatgagggttgcaaaatgttctcggacataacatttttctgtgaactcgcaacagaatcct |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
40171162 |
gcctctttggagaccagaaatccactcgatcttattctcgatgagggttgcaaaatgttctcggacataacatttttctgcgaacttgcaatggaatcct |
40171063 |
T |
 |
| Q |
212 |
tttttgtctttgcggttttggacacgcatggaacctt |
248 |
Q |
| |
|
| ||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
40171062 |
tctttgtctttgcagttttggacgcacatggaacctt |
40171026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University