View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12714_low_17 (Length: 241)
Name: NF12714_low_17
Description: NF12714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12714_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 38 - 241
Target Start/End: Original strand, 8169992 - 8170191
Alignment:
| Q |
38 |
aaataaaattaaaattttgttcccgtaggtaggcataacgtgtgcgtgcgtgcttgggaagaatcaactatactatatgccaaatttatattcattcaat |
137 |
Q |
| |
|
|||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8169992 |
aaataaaattgaaattttgttcccgtagg----cacaacgtgtgcgtgcgtgcttgggaagaatcaactatactatgtgccaaatttatattcattcaat |
8170087 |
T |
 |
| Q |
138 |
aatttttgtcgaaacataagacattcaccaccataattggtgcccatttggacggcagaatgcagagaatctaaaataataacctacctcagttgcatcc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| || |
|
|
| T |
8170088 |
aatttttgtcgaaacataagacattcaccaccataattggtacccatttggacggcagaatgcagagaatctagaataataaccttcctcagttgcaacc |
8170187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University