View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12714_low_19 (Length: 232)
Name: NF12714_low_19
Description: NF12714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12714_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 30742460 - 30742670
Alignment:
| Q |
1 |
acattgcataccatgtatataaccatctcttaaccttttccatagatttgttgataaccttaagatctttggttgaactttttccatcatttcaaaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30742460 |
acattgcataccatgtatataaccatctcttaaccttttccatagatttgttgataaccttaagatctttggttgaactttttccatcatttcaaaaaag |
30742559 |
T |
 |
| Q |
101 |
ttcaaattctttgaacctaacatagcaacattttcattaatattgcaatcactcacctctttgttgctcttgagcttatggtatatttttctctttgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30742560 |
ttcaaattctttgaacctaacatagcaacattttcattaatagtgcaatcactcacctctttgttgctcttgagcttatggtatatttttctctttgtgt |
30742659 |
T |
 |
| Q |
201 |
accttatgctt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
30742660 |
accttatgctt |
30742670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University