View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_high_22 (Length: 335)
Name: NF12715_high_22
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 25372188 - 25371856
Alignment:
| Q |
1 |
tatggaagtgtgtacctttatcaatttgagttcgatannnnnnnnctccaaccgaaatttgtccatctgtaacttatttatgtgttccttaaa---tcaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25372188 |
tatggaagtgtgtacctttatcaatttgagttcgatatttattttctccaaccgaaatttgtccatctgtaacttatttatgtgttccttaaagtatcaa |
25372089 |
T |
|
| Q |
98 |
ataaagaatggtaaatatacaatgtgtagaataagatgatatcattgagtaaactgatgcttatttatg-------tgttc---cttaattacctgtttc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || || |||||||||||||||| |
|
|
| T |
25372088 |
ataaagaatggtaaatatacaatgtgtagaataagttgatatcattgagtaaactgatgcttatgcctgaccaaaatgacaaatcttaattacctgtttc |
25371989 |
T |
|
| Q |
188 |
tttgcccttgatttcgcagcagattcgcggttcttcgccattctcttctgcctcctctcaatagtcttttccatcatctcatctgaatacttgtgcttcc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25371988 |
tttgcccttgatttcgcagcagattcgcggttcttcgccattctcttctgcctcctctcaatagtcttttccatcatctcatctgaatacttgtgcttcc |
25371889 |
T |
|
| Q |
288 |
ttccaacgccgctgccaccagcacctccctttg |
320 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
25371888 |
ttccaacgccactgccaccagcacctccctttg |
25371856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University