View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_high_28 (Length: 315)
Name: NF12715_high_28
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 37434574 - 37434729
Alignment:
| Q |
1 |
cttacatttcctttggaggtggtggcc----atggatgccttggatagcctttgatacaagcggagggagctttctgttaaacaataggactatgatgtg |
96 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37434574 |
cttacatttcctttggaggtggtagacatggatggatgccttggatagcctttgttacaagcggagggagctttctgttaaacaataggactatgatatg |
37434673 |
T |
 |
| Q |
97 |
tttcagtgtactgcttggatttctttttataagcatttgactgtggatatcaagaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434674 |
tttcagtgtactgcttggatttctttttataagcatttgactgtggatatcaagaa |
37434729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 215 - 305
Target Start/End: Original strand, 37434797 - 37434886
Alignment:
| Q |
215 |
aatattttagtgaaagggttagagtaaattgctgcttgggatgtttagggggtttatatcacaccctctgaaatacgaccttttttctctg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434797 |
aatattttagtgaaagggttagagtaaattgctgcttgggatgttta-ggggtttatatcacaccctctgaaatacgaccttttttctctg |
37434886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 50 - 124
Target Start/End: Original strand, 581026 - 581100
Alignment:
| Q |
50 |
gatacaagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttcttttt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | ||||| || | ||||||||||||||||||||||||| |
|
|
| T |
581026 |
gatacaagcggagggagctttctgttaatcaatagggccatgatatgctccagtgtactgcttggatttcttttt |
581100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 50 - 124
Target Start/End: Complemental strand, 591401 - 591327
Alignment:
| Q |
50 |
gatacaagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttcttttt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | ||||| || | ||||||||||||||||||||||||| |
|
|
| T |
591401 |
gatacaagcggagggagctttctgttaatcaatagggccatgatatgctccagtgtactgcttggatttcttttt |
591327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 580849 - 580897
Alignment:
| Q |
1 |
cttacatttcctttggaggtggtggccatggatgccttggatagccttt |
49 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
580849 |
cttacatttcctttggaggtggtcgacatggatgccttggagagccttt |
580897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 591578 - 591530
Alignment:
| Q |
1 |
cttacatttcctttggaggtggtggccatggatgccttggatagccttt |
49 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
591578 |
cttacatttcctttggaggtggtcgacatggatgccttggagagccttt |
591530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University