View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_high_30 (Length: 264)
Name: NF12715_high_30
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 16 - 123
Target Start/End: Complemental strand, 28081903 - 28081796
Alignment:
| Q |
16 |
aataatgataaaacaaaaatagttcactttagctactacatttctttctccagcagacatgaagaaaagatgttccctaattctacaactccatattaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28081903 |
aataatgataaaacaaaaatagttcactttagctactacatttctttctccagcagacatgaagaaaagatgttccctaattctacaactccatattaca |
28081804 |
T |
 |
| Q |
116 |
tagccaat |
123 |
Q |
| |
|
|||||||| |
|
|
| T |
28081803 |
tagccaat |
28081796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University