View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_high_38 (Length: 215)
Name: NF12715_high_38
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 25 - 203
Target Start/End: Original strand, 45409070 - 45409247
Alignment:
| Q |
25 |
tgttctactctattgtgtatttagcatatgataccttccttaaggtttatgctagcttaaccatttcaaatgctactaatccaatccgtgattaaggtcc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
45409070 |
tgttctactctattgtgtatttagcatatgataccttccttaaggtttatgctagcttaaccatttcaaatgctaccaatccaatccgtgattaa-gtcc |
45409168 |
T |
 |
| Q |
125 |
cataaacactgtcggtggtagataatagagtgattagccttacacgtgcttaatagtttagacagagcttccctttgct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45409169 |
cataaacactgtcggtggtagataatagagtgattagccttacacgtgcttaatagtttagacagagcttccctttgct |
45409247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University