View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_low_23 (Length: 336)
Name: NF12715_low_23
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 1785012 - 1785336
Alignment:
| Q |
1 |
acttctcaacaagtggtatcagagcccttgctcagctggatggggagcgggagtgaatctagatatgatggatccttgtatcaaaggtattattattggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1785012 |
acttctcaacaagtggtatcagagcccttgctcagttggatggggagcgggagtgaatctagatatgatggatccttgtatcaaaggtattattattggt |
1785111 |
T |
 |
| Q |
101 |
aatggagtcaggtgatatgttttgtttccgttggtttgtaacggcggtggaaatagttagaatttaagtgtgagtgattcgtctcagatcgactaaaaat |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
1785112 |
aatggagtcaggtgacatgttttgtttccgttggtttgtaacggcggtgcaaatagttggaatttaagtgtgagtaattcgtcctagatcgacaaaaaat |
1785211 |
T |
 |
| Q |
201 |
taggagaaatgactcgtatacttaattaataccttaagatttttggtgaagttgtggtgtctcataatagtgg-nnnnnnnatcaatagatgtggtgtct |
299 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1785212 |
taggagaaatgactcgtatatttaattaataccttaagatttttggtgaagctgtggtgtctcataatagtggttttttttatcaatagatgtggtgtct |
1785311 |
T |
 |
| Q |
300 |
ctttgtgatttgatttaatcctttg |
324 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1785312 |
ctttgtgatttgatttaatcctttg |
1785336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University