View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_low_27 (Length: 325)
Name: NF12715_low_27
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 37981721 - 37981447
Alignment:
| Q |
1 |
aagtagccaaactagtgaagccaatactgagggaccctcttcttctgatgaaacagatgatggcaaagagaaagagaggcatagatgatgttgaagaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37981721 |
aagtagccaaactagtgaagccaatactgagggaccctcttcttctgatgaaacagatgatggcaaagagaaagagaggcatagatgatgttgaagaaga |
37981622 |
T |
 |
| Q |
101 |
cattgatttgatttgatgttaaggaaaacatagtagtaggttgtgtatggtaaaacattgggatgtggaaataggaagtggttgatatttctattttatg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37981621 |
cattgatt-----tgatgttaaggaaaacatagtagtaggttgtgtatggtaaaacatt-ggatgtggaaataggaagtggttgatatttctattttatg |
37981528 |
T |
 |
| Q |
201 |
ttacatgcgtgcttgtataattgattggtactattgttgattctggcacggtctctatgtctctgtgtgtacagagtcaaagg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37981527 |
ttacatgcgtgcttgtataattgattggtactattgttgattctggcacggtctctatgtctc--tgtgtacagagtcaaagg |
37981447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University