View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12715_low_33 (Length: 264)

Name: NF12715_low_33
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12715_low_33
NF12715_low_33
[»] chr8 (1 HSPs)
chr8 (16-123)||(28081796-28081903)


Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 16 - 123
Target Start/End: Complemental strand, 28081903 - 28081796
Alignment:
16 aataatgataaaacaaaaatagttcactttagctactacatttctttctccagcagacatgaagaaaagatgttccctaattctacaactccatattaca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28081903 aataatgataaaacaaaaatagttcactttagctactacatttctttctccagcagacatgaagaaaagatgttccctaattctacaactccatattaca 28081804  T
116 tagccaat 123  Q
    ||||||||    
28081803 tagccaat 28081796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University