View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_low_36 (Length: 250)
Name: NF12715_low_36
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 92 - 239
Target Start/End: Complemental strand, 71372 - 71224
Alignment:
| Q |
92 |
aacataagtctattttactcaataaggtgtggtgataatttttggttcttcaaatttaaatttactttaatcaataata-tataacttttctataactga |
190 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||||||||||||||| ||||||||||||||||||| || ||| ||||| |||||||||||||| |
|
|
| T |
71372 |
aacataagtctattttgctcaataaagtgtcgtgataatttttggttcttaaaatttaaatttactttaactgatgataatataatttttctataactga |
71273 |
T |
|
| Q |
191 |
gtgcttttacaatttagagccaatgtatccaaccaaatacataattcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
71272 |
ctgcttttacaatttagagccaatgtatccaaccaaacacataattcat |
71224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 93
Target Start/End: Complemental strand, 71462 - 71393
Alignment:
| Q |
24 |
tttccttttattgtactttattaaatcttaattgattatgtgagtttgattcctagcaaactgttaaaaa |
93 |
Q |
| |
|
||||||||||||| ||| | |||||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
71462 |
tttccttttattgaactctcttaaatctgaaccgattagttgagtttgattcctagcaaactgttaaaaa |
71393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University