View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12715_low_37 (Length: 247)

Name: NF12715_low_37
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12715_low_37
NF12715_low_37
[»] chr8 (2 HSPs)
chr8 (6-145)||(39314198-39314334)
chr8 (183-247)||(39314088-39314152)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 6 - 145
Target Start/End: Complemental strand, 39314334 - 39314198
Alignment:
6 agagatgaatggtttggaagactccgagctcaagttttagagatgaaataattattagtcaaactataattaccaccacactgttgaaactatcaagact 105  Q
    |||||| |||||||||||||||||||| |||||||||||||  ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||    
39314334 agagataaatggtttggaagactccgaactcaagttttaga--tgaaataattattagtcaaactatatttaccaccacacggttgaaactatcaagact 39314237  T
106 ctcttcccttttggaattaaaggattactatcaacagaac 145  Q
    |||||||| |||||||||||||||||||||||||||||||    
39314236 ctcttccc-tttggaattaaaggattactatcaacagaac 39314198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 183 - 247
Target Start/End: Complemental strand, 39314152 - 39314088
Alignment:
183 ctttctttcactgactgttttgcagaaaaaggtaaattcaacgttacatgctacatatatagttt 247  Q
    |||||| ||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||    
39314152 ctttctatcactgattgttttgcagaaaaaggtaaatacaacgttaaatgctacatatatagttt 39314088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University