View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_low_40 (Length: 227)
Name: NF12715_low_40
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 25 - 209
Target Start/End: Original strand, 3807188 - 3807372
Alignment:
| Q |
25 |
tgctatcacctcttgccgagactgcttaatgagggaagtttttaggaggcttcacaaaactggtttcaatattgctatttgtaaaacaaaatggagaact |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807188 |
tgctatcacctcttgccgagactgcttaatgagggaagtttttacgaggcttcacaaaactggtttcaatattgctatttgtaaaacaaaatggagaact |
3807287 |
T |
|
| Q |
125 |
tcatcagatattccatcaggtaaatgtcatttattgctaacaaatatagttatgaaaagcaatattattagaatttacgaccttc |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807288 |
tcatcagatattccatcaggtatatgtgatttattgctaacaaatatagttatgaaaagcaatattattagaatttacgaccttc |
3807372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 22 - 146
Target Start/End: Original strand, 3775231 - 3775355
Alignment:
| Q |
22 |
gggtgctatcacctcttgccgagactgcttaatgagggaagtttttaggaggcttcacaaaactggtttcaatattgctatttgtaaaacaaaatggaga |
121 |
Q |
| |
|
|||||| |||||| | ||| || ||||||||||||||||||||| || ||||||||| ||| |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3775231 |
gggtgccatcaccacctgcagaaactgcttaatgagggaagtttctatgaggcttcagaaagctggtttcaatagtgctatttgcaaaacaaaatggaga |
3775330 |
T |
|
| Q |
122 |
acttcatcagatattccatcaggta |
146 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
3775331 |
acttcatcagatattccgtcaggta |
3775355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University