View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12715_low_42 (Length: 215)
Name: NF12715_low_42
Description: NF12715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12715_low_42 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 52488607 - 52488805
Alignment:
| Q |
17 |
agttttgggatcaagaaatgttttcactgtgttccatagaagcttaaaaccaggaccagcattgatgataaacatttgatgaagtgtctgcgcaatgtca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52488607 |
agttttgggatcaagaaatgttttcactgtgttccatagaagcttaaaaccaggaccagcattgatgataaacatttgatgaagtgtctgcgcaatgtca |
52488706 |
T |
|
| Q |
117 |
gttacatatcttaaatgaggaacactacaaataattagaaaaatgagctttaaaaaatttaacgatttagacatggttctttgtttatgtgagcttctc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52488707 |
gttacatatcttaaatgaggaacactacaaataattagaaaaatgagcttttaaaaatttaacgatttagacatggttctttgtttatgtgagcttctc |
52488805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 17 - 92
Target Start/End: Original strand, 7209354 - 7209429
Alignment:
| Q |
17 |
agttttgggatcaagaaatgttttcactgtgttccatagaagcttaaaaccaggaccagcattgatgataaacatt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
7209354 |
agttttgggatcaagaaatgttttcactgtgttccaaagtagcttgaaaccaggaccagcgttgattataaacatt |
7209429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University