View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12716_high_15 (Length: 230)
Name: NF12716_high_15
Description: NF12716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12716_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 38 - 214
Target Start/End: Complemental strand, 32551964 - 32551787
Alignment:
| Q |
38 |
tttataatttgcggtttcttttattttaaaatcgcaacaatggttgtaaatgtgtgttcgatgttttgatttaccatagg-taagattggtccattgatg |
136 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
32551964 |
tttataatttgcagtttcttttattttaaaatcgcaacaatggttgtaaatgtgtgtccgatgttttgatttaccataggataagattggtccagtgatg |
32551865 |
T |
 |
| Q |
137 |
tgtacacttttataaatagaaatttaattttaacatcaatttgagacacctaaatttgacaactttttacatggttaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32551864 |
tgtacacttttataaatagaaatttaattttaacatcaatttgagacacctaaatttgacaactttttacatggttaa |
32551787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 1428679 - 1428647
Alignment:
| Q |
181 |
gacacctaaatttgacaactttttacatggtta |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
1428679 |
gacacctaaatttgacaactttttacgtggtta |
1428647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University