View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12716_high_17 (Length: 223)
Name: NF12716_high_17
Description: NF12716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12716_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 80 - 206
Target Start/End: Complemental strand, 29894913 - 29894787
Alignment:
| Q |
80 |
gaagaatgagtccattgcaggtaccaaccatacgagagcatccattccattcctcgtctttgaataggtagcaacgatcgatggaaagagtggacgaccg |
179 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| |||| ||||||||||||||||||||||||||||||| |||| |||||||| ||||| | |
|
|
| T |
29894913 |
gaagaatgagtccattgcaggtaccaagcatacgagtgcattcattgcattcctcgtctttgaataggtagcaacgattgatgaaaagagtgaacgacgg |
29894814 |
T |
|
| Q |
180 |
gttttcaatcaaatgttgcatggagca |
206 |
Q |
| |
|
||||||||| ||| ||||||||||||| |
|
|
| T |
29894813 |
gttttcaattaaacgttgcatggagca |
29894787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University