View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12716_low_19 (Length: 208)
Name: NF12716_low_19
Description: NF12716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12716_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 1025790 - 1025980
Alignment:
| Q |
1 |
tctttggctcaactccaacaataggaggtatttatgatgaagaatcatactcaatgaactttgataaaggaagtgggtggatggagcctgataatctccc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1025790 |
tctttggctcaactccaacaatagaaggtatttatgatgaagaatcatactcaatgaactttgataaaggaagtgggtggatggagcctgataatctccc |
1025889 |
T |
|
| Q |
101 |
tcgttctttctcttctaggtatgctgacccatctaggatcttaccacgaagacatttgttgaattagtttatgattaaaagatgtaagaac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1025890 |
tcgttctttctcttctaggtatgctgacccatctaggatcttaccacgaagacatttgttgaattagtttatgattaaaagatgtaagaac |
1025980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 33 - 143
Target Start/End: Complemental strand, 50613535 - 50613425
Alignment:
| Q |
33 |
tatgatgaagaatcatactcaatgaactttgataaaggaagtgggtggatggagcctgataatctccctcgttctttctcttctaggtatgctgacccat |
132 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||| | |||| || |||||||| || ||||||||||||||||| || || || |||||||||| |||| |
|
|
| T |
50613535 |
tatgatcaagatacatactcaatgaattttgatcatggaacaggttggatggaaccagataatctccctcgttcattttcagctcggtatgctgatccat |
50613436 |
T |
|
| Q |
133 |
ctaggatctta |
143 |
Q |
| |
|
| |||||||| |
|
|
| T |
50613435 |
gttggatctta |
50613425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University