View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12717_high_7 (Length: 261)
Name: NF12717_high_7
Description: NF12717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12717_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 21 - 253
Target Start/End: Complemental strand, 54971886 - 54971654
Alignment:
| Q |
21 |
atcacctctaccgtatggactatatggactttgttaaagtagggatcatgtcaaccaattaagcaatattctctctttcagttcagtagattaattcaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54971886 |
atcacctctaccgtatggactatatggactttgttaaagtagggatcatgtcaaccaattaagcaatattctctctttcagttcagtagattaattcaaa |
54971787 |
T |
 |
| Q |
121 |
ttattgactcttaagacgttttccaggatcatcgagagagcggtgcagatatcactctttcttgtctgccaatggatgacaggtaagttacttccccgaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54971786 |
ttattgactcttaagacgttttccaggatcatcgagagagcggtgcagatatcactctttcttgtctgccaatggatgacaggtaagttacttccccgaa |
54971687 |
T |
 |
| Q |
221 |
gtagtaagattcatgtcatttagtgttcatctc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
54971686 |
gtagtaagattcatgtcatttagtgttcatctc |
54971654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University