View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12717_low_12 (Length: 244)
Name: NF12717_low_12
Description: NF12717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12717_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 44764005 - 44763787
Alignment:
| Q |
14 |
tcaaaatttgggcgttcggaataattctcaggtttcttctacttacttatgccattgctggaattgtgaaatagaataaattactagtattttagtctgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44764005 |
tcaaaatttgggcgttcggaataattctcaggtttcttctacttacttatgccattgctggaattgtgaaatagaataaattactagtattttagtctgc |
44763906 |
T |
|
| Q |
114 |
attgatcatgtgaccaaaagaatgtcatattcgcaatatcatttattgtattaaaattgctgccattaccaactacaaagtttcaaattcgtaatgccat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44763905 |
attgatcatgtgaccaaaagaatgtcatattcgcaatatcatttattgtattaaaattgctgccattaccaactacaaagtttcaaattcgtaatgccat |
44763806 |
T |
|
| Q |
214 |
gtatagaatggtctctgct |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44763805 |
gtatagaatggtctctgct |
44763787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 14 - 144
Target Start/End: Complemental strand, 28357377 - 28357247
Alignment:
| Q |
14 |
tcaaaatttgggcgttcggaataattctcaggtttcttctacttacttatgccattgctggaattgtgaaatagaataaattactagtattttagtctgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28357377 |
tcaaaatttgggcgttcggaataattctcaggtttcttctacttacttatgccattgctggaattgtgaaatagaataaattactagtattttagtctgc |
28357278 |
T |
|
| Q |
114 |
attgatcatgtgaccaaaagaatgtcatatt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28357277 |
attgatcatgtgaccaaaagaatgtcatatt |
28357247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University