View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12717_low_6 (Length: 313)
Name: NF12717_low_6
Description: NF12717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12717_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 10930344 - 10930640
Alignment:
| Q |
1 |
ctccttccatgtatcctcttcaacatcatacacaactccttctttagcagcatcgccttttacgtttaccatataaagctttcctctccatcctacagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10930344 |
ctccttccatgtatcctcttcaacatcatacacaactccttctttagcagcatcgccttttacgtttaccatataaagctttcctctccatccaacagca |
10930443 |
T |
 |
| Q |
101 |
tctacagcttccctgctgaatctgccgtccttcatatcggttttcttctcccaaatgggatcgttgatcgggtcccacttctctattgactttgctacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930444 |
tctacagcttccctgctgaatctgccgtccttcatatcggttttcttctcccaaatgggatcgttgatcgggtcccacttctctattgactttgctacat |
10930543 |
T |
 |
| Q |
201 |
caactgagaaatgggacccaataccacttgctacatagaccataccttctgatgtgcctaatgcacaccagcggcgtggattagttagggcaggtcc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930544 |
caactgagaaatgggacccaataccacttgctacatagaccataccctctgatgtgcctaatgcacaccagcggcgtggattagttagggcaggtcc |
10930640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University