View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12718_low_17 (Length: 308)
Name: NF12718_low_17
Description: NF12718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12718_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 166 - 290
Target Start/End: Complemental strand, 28470394 - 28470270
Alignment:
| Q |
166 |
ggtgagattttttaatattagatgaatgaaaaagagagagaagggtaccctgaagttgaacttgcaaattcagaaagctttccacgacttgagaaaatga |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28470394 |
ggtgagattttttaatattagatgaatgaaaaagagagagaagggtaccctgaagttgaacttgcaaattcagaaagctttccacgacttgagaaaatga |
28470295 |
T |
 |
| Q |
266 |
taagagcaatctcagcatcacatag |
290 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
28470294 |
taagagcaatctcagcatcacatag |
28470270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 231 - 287
Target Start/End: Complemental strand, 5230112 - 5230056
Alignment:
| Q |
231 |
aaattcagaaagctttccacgacttgagaaaatgataagagcaatctcagcatcaca |
287 |
Q |
| |
|
||||||| |||||||||||||| | ||||| ||||||||||||| |||||||||||| |
|
|
| T |
5230112 |
aaattcataaagctttccacgagtggagaagatgataagagcaacctcagcatcaca |
5230056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University