View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12718_low_17 (Length: 308)

Name: NF12718_low_17
Description: NF12718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12718_low_17
NF12718_low_17
[»] chr7 (2 HSPs)
chr7 (166-290)||(28470270-28470394)
chr7 (231-287)||(5230056-5230112)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 166 - 290
Target Start/End: Complemental strand, 28470394 - 28470270
Alignment:
166 ggtgagattttttaatattagatgaatgaaaaagagagagaagggtaccctgaagttgaacttgcaaattcagaaagctttccacgacttgagaaaatga 265  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28470394 ggtgagattttttaatattagatgaatgaaaaagagagagaagggtaccctgaagttgaacttgcaaattcagaaagctttccacgacttgagaaaatga 28470295  T
266 taagagcaatctcagcatcacatag 290  Q
    |||||||||||||||||||||||||    
28470294 taagagcaatctcagcatcacatag 28470270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 231 - 287
Target Start/End: Complemental strand, 5230112 - 5230056
Alignment:
231 aaattcagaaagctttccacgacttgagaaaatgataagagcaatctcagcatcaca 287  Q
    ||||||| |||||||||||||| | ||||| ||||||||||||| ||||||||||||    
5230112 aaattcataaagctttccacgagtggagaagatgataagagcaacctcagcatcaca 5230056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University