View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12718_low_21 (Length: 239)
Name: NF12718_low_21
Description: NF12718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12718_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 91 - 228
Target Start/End: Original strand, 3679940 - 3680083
Alignment:
| Q |
91 |
gcagcttcatgcaagggcagcttttgaagaagatgcctgtttaattatcttggt--------acaatgtactgaaagaagagtttggaactgtaacttcg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3679940 |
gcagcttcatgcaagggcagcttttgaagaagatgcctgtttaattatcttggtttggttatacaatgtactgaaagaagagtttggaactgcaacttcg |
3680039 |
T |
|
| Q |
183 |
tttgagacttgttatatgatgtataaactttttctgttttgttcat |
228 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3680040 |
tttgagacttgt--tatgatgtataaactttttctgttttgttcat |
3680083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 92 - 134
Target Start/End: Original strand, 3686712 - 3686754
Alignment:
| Q |
92 |
cagcttcatgcaagggcagcttttgaagaagatgcctgtttaa |
134 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
3686712 |
cagcttcatgcaagggcaacttttgaggaagatgcctgtttaa |
3686754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University