View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12718_low_24 (Length: 215)
Name: NF12718_low_24
Description: NF12718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12718_low_24 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 98 - 215
Target Start/End: Original strand, 2926158 - 2926275
Alignment:
| Q |
98 |
ttctcagcaattaaacattttattaccttcctaaaaatattgcgaacaggttcaacaatgctacgcgcttcaacggtgccgcaagtgacgctaggaagca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2926158 |
ttctcagcaattaaacattttattaccttcctaaaaatattgcgaacaggttcaacaatgctacgcgcttcaacagtgccgcaagtgacgctaggaagca |
2926257 |
T |
|
| Q |
198 |
aaggagtgaatgcaaaat |
215 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2926258 |
aaggagtgaatgcaaaat |
2926275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Original strand, 2926072 - 2926103
Alignment:
| Q |
12 |
cactgatcacagctgtatacagtataagtttt |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2926072 |
cactgatcacagctgtatacagtataagtttt |
2926103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University