View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12718_low_3 (Length: 501)
Name: NF12718_low_3
Description: NF12718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12718_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 333; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 18 - 388
Target Start/End: Complemental strand, 2437772 - 2437398
Alignment:
| Q |
18 |
gtctctgctaggaagctcgcggcggctctttgggaattcaaccattacttcccactcttccaaatgcataacggtggtgccgccgattcgagacttctcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2437772 |
gtctctgctaggaagctcgcggcggctctttgggaattcaaccattacttcccactcttccaaatgcataacggtggtgccgccgattcgagacttctcc |
2437673 |
T |
 |
| Q |
118 |
gccgccattatacacttcacaaagacaaagctcatgatatctctaatttcttagttgatgcttctcctagttctcctgatcaggttccaccttctttttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2437672 |
gccgccattatacacttcacaaagacaaagctcatgatatctctaatttcctagttgatgcttctcctagttctcctgatcaggttccaccttctttttt |
2437573 |
T |
 |
| Q |
218 |
aactttttctaaagtaaaatttcttagctgatttggtgtattggcttgtgagggttatactattcagtatttactttttagtctgcattttgtttaattt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2437572 |
aactttttctaaagtaaaatttcttagctgatttggtgtattggcttgtgagggttatactattcagtatttactttttagtctgcattttgtttaattt |
2437473 |
T |
 |
| Q |
318 |
gatactttattatctgatcccgtgcatttcatttg----nnnnnnnatttggtatttgctacttgaggtaaattc |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2437472 |
gatactttattatctgatcccgtgcatttcatttgtttttttttttatttggtatttgctacttgaggtaaattc |
2437398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 459 - 493
Target Start/End: Complemental strand, 2437327 - 2437293
Alignment:
| Q |
459 |
ctgttgaatatgtttgttgacttgtcttctgtgct |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
2437327 |
ctgttgaatatgtttgttgacttgtcttctatgct |
2437293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University