View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12719_high_14 (Length: 235)
Name: NF12719_high_14
Description: NF12719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12719_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 80 - 223
Target Start/End: Original strand, 26453321 - 26453464
Alignment:
| Q |
80 |
attttactttatgtaggctcctcatatttcttctctcattttccaatatacctcttctctcactgcttttcttaccttttctgtactttttctaatgcag |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26453321 |
attttactttatgtaggctcctcatatttcttctctcattttccaatatacctcttctctctctgcttttcttaccttttctgtactttttctaatgcag |
26453420 |
T |
 |
| Q |
180 |
tcagtgctagaacatgttctagtgggagaatttttctccacagg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26453421 |
tcagtgctagaacatgttctagtgggagaattgttctccacagg |
26453464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 30264520 - 30264474
Alignment:
| Q |
1 |
aaaagacaaacccctttgggaaacacatgttatcaagtatccaacaa |
47 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30264520 |
aaaagacaaacccctttgggaaatacatgttatcaagtatccaacaa |
30264474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 30287668 - 30287714
Alignment:
| Q |
1 |
aaaagacaaacccctttgggaaacacatgttatcaagtatccaacaa |
47 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30287668 |
aaaagacaaacccctttgggaaatacatgttatcaagtatccaacaa |
30287714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 162
Target Start/End: Complemental strand, 47680488 - 47680406
Alignment:
| Q |
80 |
attttactttatgtaggctcctcatatttcttctctcattttccaatatacctcttctctcactgcttttcttaccttttctg |
162 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||| || |||| ||||||||||||||| | ||| |||||| ||||||| |
|
|
| T |
47680488 |
attttactttatgtaggaccctcgtgtttcttctcttatcatccattatacctcttctctctccccttctcttactttttctg |
47680406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University