View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12719_low_11 (Length: 297)
Name: NF12719_low_11
Description: NF12719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12719_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 51 - 297
Target Start/End: Original strand, 2638027 - 2638274
Alignment:
| Q |
51 |
tggttcggtttcatttcatgcgaaattggtgattttgcctaaa-ctaacacaatgaacaaatagattgattatgatttggtttgttcatattataaaaaa |
149 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2638027 |
tggttcggtttcatttcatacgaaattgatgattttgcctaaaactaacacaatgaaaaaatagattgattatggtttggtttgttcatattataaaaaa |
2638126 |
T |
 |
| Q |
150 |
gtgagaaattgcaacaacaacaaaaaagttataaacgtgtgcctctgccctccgctacctgcttcaatttatttgataatgaatcaattagaactcaagg |
249 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2638127 |
gtgagaaattgcaacaacaa-aaaaaagttataaacgtgtgcctctgccctctgctacctgcttcaatttatttgataatgaatcaattaaaactcaagg |
2638225 |
T |
 |
| Q |
250 |
aaaac-aaaaaatttgttaatgaattaagcaaaggacaaatcgatgaac |
297 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||| |||||||||| |
|
|
| T |
2638226 |
aaaacaaaaaaaattattaatgaattaagcaaaggacagatcgatgaac |
2638274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University