View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12719_low_13 (Length: 265)

Name: NF12719_low_13
Description: NF12719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12719_low_13
NF12719_low_13
[»] chr2 (1 HSPs)
chr2 (132-247)||(9412421-9412536)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 132 - 247
Target Start/End: Complemental strand, 9412536 - 9412421
Alignment:
132 tgacccaacttcaactgttgttgatgagtagtttcttaaactttaaactactaatatacaaggttttgaattgtggctgtggaaactgttgcaatcattg 231  Q
    |||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||    
9412536 tgacgcaacttcaactgttgttcatgagtagtttcttaaactataaactactaatatccaaggttttgaattgtggctgtggatactattgcaatcattg 9412437  T
232 atattgcagagaatca 247  Q
    ||||||||||||||||    
9412436 atattgcagagaatca 9412421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University