View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12719_low_13 (Length: 265)
Name: NF12719_low_13
Description: NF12719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12719_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 132 - 247
Target Start/End: Complemental strand, 9412536 - 9412421
Alignment:
| Q |
132 |
tgacccaacttcaactgttgttgatgagtagtttcttaaactttaaactactaatatacaaggttttgaattgtggctgtggaaactgttgcaatcattg |
231 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
9412536 |
tgacgcaacttcaactgttgttcatgagtagtttcttaaactataaactactaatatccaaggttttgaattgtggctgtggatactattgcaatcattg |
9412437 |
T |
 |
| Q |
232 |
atattgcagagaatca |
247 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9412436 |
atattgcagagaatca |
9412421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University