View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12719_low_16 (Length: 244)
Name: NF12719_low_16
Description: NF12719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12719_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 21 - 232
Target Start/End: Complemental strand, 2637927 - 2637718
Alignment:
| Q |
21 |
ttattcattattcttaccaatcgagttaagtttacgtgaacaacatgttacactctaatgaagggtcccataaactttgaaaaattacttagttttttaa |
120 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2637927 |
ttattcattatcgttaccaaccgagttaagtttacgtgtacaacatgttacactctaatgaagggtcccagaaactttaaaaaattacttagttttttaa |
2637828 |
T |
|
| Q |
121 |
ttgaaacttcaaaatannnnnnnctaaagctcactagctgacagtaaaatgttatttaagcagaaaaagtttacatgatattggagcattatacatggtt |
220 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2637827 |
ttgaaacttc--aatatttttttctaaagctcactagctggcagtaaaatgttatttaagcagaaaaagtttacatgatattggagcattatacatggtt |
2637730 |
T |
|
| Q |
221 |
atatacagtgaa |
232 |
Q |
| |
|
||||||| |||| |
|
|
| T |
2637729 |
atatacattgaa |
2637718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University