View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_130 (Length: 261)
Name: NF1271_high_130
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_130 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 7e-58; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 148 - 261
Target Start/End: Complemental strand, 29583452 - 29583339
Alignment:
| Q |
148 |
aatttacacatcctaaattccctgcttagtaaatagataaacatcagatatagaacttacaatttgcatatgtgaatggacaggtctgcaaagatcccag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583452 |
aatttacacatcctaaattccctgcttagtaaatagataaacatcagatatagaacttacaatttgcatatgtgaatggacaggtctgcaaagatcccag |
29583353 |
T |
 |
| Q |
248 |
atggggaagatgct |
261 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29583352 |
atggggaagatgct |
29583339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 30 - 133
Target Start/End: Complemental strand, 29583579 - 29583476
Alignment:
| Q |
30 |
tatgttatgtgttttgttaggattctttgaggcaacaagagaaaaaagggaattattcgtccctggagtttgtacacaagagagattactcttttcatgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29583579 |
tatgttatgtgttttgttaggattctttgaggcaacaagagaaaaaagggaattattcgtccctggagtttgtacacaagagagattactcttttcatgt |
29583480 |
T |
 |
| Q |
130 |
tgcg |
133 |
Q |
| |
|
|||| |
|
|
| T |
29583479 |
tgcg |
29583476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 211 - 261
Target Start/End: Original strand, 29610812 - 29610862
Alignment:
| Q |
211 |
ttgcatatgtgaatggacaggtctgcaaagatcccagatggggaagatgct |
261 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| |||||||| ||||||| |
|
|
| T |
29610812 |
ttgcatatgtgaatgaataggtctgcaaagatcctagatggggtagatgct |
29610862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 96
Target Start/End: Complemental strand, 22173868 - 22173816
Alignment:
| Q |
44 |
tgttaggattctttgaggcaacaagagaaaaaagggaattattcgtccctgga |
96 |
Q |
| |
|
|||||| |||||||||||||||| || | |||||| |||||||||||||||| |
|
|
| T |
22173868 |
tgttagtattctttgaggcaacaggaacataaaggggattattcgtccctgga |
22173816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University