View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_151 (Length: 251)
Name: NF1271_high_151
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_151 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 54002112 - 54002356
Alignment:
| Q |
1 |
ttacatggcaggtcctcgtgtcattaattttaataggccaacttgaaggggaaaaaagatcatccagaatctgcgattgccagagatcannnnnnnnnca |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
54002112 |
ttacatggtaggtcctcgtgtcattaattttaataggccaacttgaaggggaaaaaagatcattcagaatctgcgattgccagagatcatttttttttca |
54002211 |
T |
|
| Q |
101 |
gagaacttgtttatttagatccatctccatgccaaatattaacagatagataaggaagctcatactacattgaaacaacttatacattacatgtaaagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54002212 |
gagaacttgtttatttagatccatctccatgccaaatattaacagatagataaggaagctcatactacattgaaacaacttatacattacatgtaaagta |
54002311 |
T |
|
| Q |
201 |
taccaaaatacgttacagaaacaaatttgtcattagtataatcta |
245 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54002312 |
taccaaaatacgttacaaaaacaaatttgtcattagtataatcta |
54002356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University