View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_163 (Length: 251)
Name: NF1271_high_163
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_163 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 72 - 184
Target Start/End: Complemental strand, 6175403 - 6175291
Alignment:
| Q |
72 |
tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttacgaagaagtggagaaagtgataaaatcagtacaaaaatc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175403 |
tatactctacgcttaagttctgcttcataaaaaggtcaaactcaatttcgaaaattagttatgaagaagtggagaaagtgataaaatcagtacaaaaatc |
6175304 |
T |
 |
| Q |
172 |
caagttaatgagc |
184 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6175303 |
caagttaatgagc |
6175291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University