View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_168 (Length: 244)
Name: NF1271_high_168
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_168 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 36085078 - 36084851
Alignment:
| Q |
1 |
ctggaggagagtcatgtcgccaactctcccaataccatgttggtaaacttatgagttttaacattcatacaatcacattcactagtatgtcataatgcat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36085078 |
ctggaggaaagtcatgtcgccaactctcccaataccatgttgataaacttatgagttttaacattcatacaatcacattcactaatatgtcataatgcat |
36084979 |
T |
 |
| Q |
101 |
tattgttgtagggaatatatgcataaatatctatattgtaaaatatgattggacatctgtattagttgttttacactgcgccactgcgaagtaagtaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
36084978 |
tattgttgtagggaatatatgcataaatatctatattgtaaaatatgattggacgtttgtattagttgttttacactgcaccactacgaagtaagtaaat |
36084879 |
T |
 |
| Q |
201 |
tctaaataatattatcatttcatatgaa |
228 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
36084878 |
tctaaataatattttcatttcatatgaa |
36084851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University