View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_183 (Length: 209)
Name: NF1271_high_183
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_183 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 75 - 209
Target Start/End: Complemental strand, 14000510 - 14000382
Alignment:
| Q |
75 |
aatcaatcgtctctcatactagtaagttcttctctcaactcaatcaatcatcttttgnnnnnnnnnnnnnnaattagaattttcctcaaattctagggtt |
174 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
14000510 |
aatcaatcgtctcttatactagtgagttcttctctcaactcaatcaatcatcttatgtttttttt------aattagaattttcctcaaattctagggtt |
14000417 |
T |
 |
| Q |
175 |
tctattcatgtgtgattttctccaattctagggta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14000416 |
tctattcatgtgtgattttctccaattctagggta |
14000382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University