View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1271_high_67 (Length: 389)
Name: NF1271_high_67
Description: NF1271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1271_high_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 91 - 298
Target Start/End: Original strand, 31395389 - 31395595
Alignment:
| Q |
91 |
gatatatatctttaatttgccaaccacacatgatctaagtgaagatgaaacagtttgagttttgttttagacaataggttagctagctttgttttatttt |
190 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31395389 |
gatatgtatctttaatttgccaacgacacatgatctaagtgaagatgaaacagtttgagttttgttttagacaataggttagctagctttgttttatttt |
31395488 |
T |
|
| Q |
191 |
aattatacactccactctttattccttcatcaagtatttatatctcagggttttcctagtaatttatttaatgaaacatttgttcaccgtagcatgattg |
290 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31395489 |
aatt-tacactccactctttattccttcatcaaggttttatatctcagggttttcctagtaatttatttaatgaaacatttgttcaccgtagcatgattg |
31395587 |
T |
|
| Q |
291 |
taaccttg |
298 |
Q |
| |
|
|||||||| |
|
|
| T |
31395588 |
taaccttg |
31395595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University